i corynebacterium glutamicum i atcc 13869 strain (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC i corynebacterium glutamicum i atcc 13869 strain
I Corynebacterium Glutamicum I Atcc 13869 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/corynebacterium+glutamicum+atcc+13869+strain/Corynebacterium+glutamicum/us12545939-215-17-19
Average 94 stars, based on 3 article reviews

i corynebacterium glutamicum i atcc 13869 strain - by Bioz Stars, 2026-10

94/100 stars

Images

Amplification:

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: TABLE 10 SEQ ID NO. Primer Sequence (5′-3′) 22 NCgl1514-5F CCGGGGATCCTCTAGACTGAAGGTGCCAACAC TCAGC 23 NCgl1514-5R GATGGTAGTGTCACGATCCTTTC 24 PC7-F(1514) gatcgtgacactaccatcGCCGGCATAGCCTA CCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 25 NCgl1514-3F aaggaaacactgatatcGTGAGCACAAACACG (C7-GTG) ACCCCC 26 NCgl1514-3R GCAGGTCGACTCTAGACGGTGGATTCAGCCAT GCC Further, through PCR reaction and sequencing based on the nucleotide sequence of Corynebacterium glutamicum ATCC 13032, an amino acid sequence (SEQ ID NO: 27) and a nucleotide sequence (SEQ ID NO: 28) of the gene having homology to NCg11514 encoding G6PD of Corynebacterium glutamicum ATCC 13869 were obtained from NIH GenBank. .. Similarly, two gene fragments of about 0.5 kb were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and primers of SEQ ID NOS: 22 and 29 and primers of SEQ ID NOS: 25 and 26 (Table 11). .. Similarly, two gene fragments of about 0.5 kb were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and primers of SEQ ID NOS: 22 and 29 and primers of SEQ ID NOS: 25 and 26 (Table 11).

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: TABLE 27 SEQ ID NO. Primer Sequence (5′-3′) 67 1′NCgl2431-F aaggaaacactgatatcATGAATACCAATCCG TCTGAATTCTCC 68 1′NCgl2431-R gccaaaacagcctcgagCTAAGCGGCCGGCGG GAA 5 CJ7-F ggcccactagtctcgagGCCGGCATAGCCTAC CGAT 6 CJ7-R GATATCAGTGTTTCCTTTCGTTGG Further, through PCR reaction and sequencing based on the nucleotide sequence of Corynebacterium glutamicum ATCC 13032, an amino acid sequence (SEQ ID NO: 69) and a nucleotide sequence (SEQ ID NO: 70) of the gene having homology to NCg12431 of Corynebacterium glutamicum ATCC 13869 were obtained. .. Similarly, a gene fragment of about 1.45 kb was amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and primers of SEQ ID NOS: 71 and 72 (Table 28). .. Similarly, a gene fragment of about 1.45 kb was amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and primers of SEQ ID NOS: 71 and 72 (Table 28).

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: The fusion cloning was performed using an In-Fusion® HD cloning kit (Clontech). .. TABLE 13 SEQ ID NO. Primer Sequence (5′-3′) 22 NCgl1514-5F CCGGGGATCCTCTAGACTGAAGGTGCCAACAC TCAGC 23 NCgl1514-5R GATGGTAGTGTCACGATCCTTTC 24 PC7-F(1514) gatcgtgacactaccatcGCCGGCATAGCCTA CCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 31 NCgl1514-3F aaggaaacactgatatcATGAGCACAAACACG (C7-ATG) ACCCCC 26 NCg11514-3R GCAGGTCGACTCTAGACGGTGGATTCAGCCAT GCC Similarly, two gene fragments of about 0.5 kb were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and primers of SEQ ID NOS: 22 and 29 and primers of SEQ ID NOS: 31 and 26 (Table 14). .. TABLE 13 SEQ ID NO. Primer Sequence (5′-3′) 22 NCgl1514-5F CCGGGGATCCTCTAGACTGAAGGTGCCAACAC TCAGC 23 NCgl1514-5R GATGGTAGTGTCACGATCCTTTC 24 PC7-F(1514) gatcgtgacactaccatcGCCGGCATAGCCTA CCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 31 NCgl1514-3F aaggaaacactgatatcATGAGCACAAACACG (C7-ATG) ACCCCC 26 NCg11514-3R GCAGGTCGACTCTAGACGGTGGATTCAGCCAT GCC Similarly, two gene fragments of about 0.5 kb were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and primers of SEQ ID NOS: 22 and 29 and primers of SEQ ID NOS: 31 and 26 (Table 14).

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: The fusion cloning was performed using an In-Fusion® HD cloning kit (Clontech). .. TABLE 8 SEQ ID NO. Primer Sequence (5′-3′) 12 NCgl1512_5F CCGGGGATCCTCTAGAGTAGACGCT TGATTGGCGGAC 13 NCgl1512_5R TCCTTCCTGGGTTAAACCGGG 18 NCgl1512-PC7-F gtttaacccaggaaggaGCCGGCAT AGCCTACCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 19 NCgl1512-PC7-ATG-F aaggaaacactgatatcaTGACCAC CTTGACGCTGTCAC 15 NCgl1512_3R GCAGGTCGACTCTAGAGTCGAATAG GCCACGCTCAC Similarly, three gene fragments were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers, and a vector was prepared in the same manner as above. .. TABLE 8 SEQ ID NO. Primer Sequence (5′-3′) 12 NCgl1512_5F CCGGGGATCCTCTAGAGTAGACGCT TGATTGGCGGAC 13 NCgl1512_5R TCCTTCCTGGGTTAAACCGGG 18 NCgl1512-PC7-F gtttaacccaggaaggaGCCGGCAT AGCCTACCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 19 NCgl1512-PC7-ATG-F aaggaaacactgatatcaTGACCAC CTTGACGCTGTCAC 15 NCgl1512_3R GCAGGTCGACTCTAGAGTCGAATAG GCCACGCTCAC Similarly, three gene fragments were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers, and a vector was prepared in the same manner as above.

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: TABLE 32 SEQ ID NO. Primer Sequence (5′-3′) 83 NCgl1358-F AAGGAAACACTGATATC_ATGACTGCACCCACG AACGC 84 NCgl1358-R GCCAAAACAGCCTCGAG TTACCCCGCTGACCT GGG 5 CJ7-F GGCCCACTAGTCTCGAG GCCGGCATAGCCTAC CGAT 6 CJ7-R GATATCAGTGTTTCCTTTCGTTGG Further, through PCR reaction and sequencing based on the nucleotide sequence of Corynebacterium glutamicum ATCC 13032, an amino acid sequence (SEQ ID NO: 85) and a nucleotide sequence (SEQ ID NO: 86) of the gene having homology to ppnK-encoding NCg11358 of Corynebacterium glutamicum ATCC 13869 were obtained. .. Similarly, a gene fragment of about 0.96 kb was amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers. .. Similarly, a gene fragment of about 0.96 kb was amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers.

Bacteria:

Article Title: Corynebacterium for producing L-lysine by fermentation
Article Snippet: .. However, most of the promoters of Corynebacterium bacteria in the prior art are still wild type promoters, such as Corynebacterium glutamicum ATCC 13869 strain (see GenBank: CP016335.1, pp. ..

Article Title:
Article Snippet: .. However, most of the promoters of Corynebacterium bacteria in the prior art are still wild type promoters, such as Corynebacterium glutamicum ATCC 13869 strain (see GenBank: CP016335.1, pp. ..

Sequencing:

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: The fusion cloning was performed using an In-Fusion® HD cloning kit (Clontech). .. TABLE 8 SEQ ID NO. Primer Sequence (5′-3′) 12 NCgl1512_5F CCGGGGATCCTCTAGAGTAGACGCT TGATTGGCGGAC 13 NCgl1512_5R TCCTTCCTGGGTTAAACCGGG 18 NCgl1512-PC7-F gtttaacccaggaaggaGCCGGCAT AGCCTACCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 19 NCgl1512-PC7-ATG-F aaggaaacactgatatcaTGACCAC CTTGACGCTGTCAC 15 NCgl1512_3R GCAGGTCGACTCTAGAGTCGAATAG GCCACGCTCAC Similarly, three gene fragments were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers, and a vector was prepared in the same manner as above. .. TABLE 8 SEQ ID NO. Primer Sequence (5′-3′) 12 NCgl1512_5F CCGGGGATCCTCTAGAGTAGACGCT TGATTGGCGGAC 13 NCgl1512_5R TCCTTCCTGGGTTAAACCGGG 18 NCgl1512-PC7-F gtttaacccaggaaggaGCCGGCAT AGCCTACCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 19 NCgl1512-PC7-ATG-F aaggaaacactgatatcaTGACCAC CTTGACGCTGTCAC 15 NCgl1512_3R GCAGGTCGACTCTAGAGTCGAATAG GCCACGCTCAC Similarly, three gene fragments were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers, and a vector was prepared in the same manner as above.

other:

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: TABLE 22 SEQ ID NO. Primer Sequence (5′-3′) 55 NCgl2905- CCGGGGATCCTCTAGACTGGGTCGTGGCATAAGAA del-5F 56 NCgl2905- GTGCCTTTGATTGGGCAGC del-5R 57 NCgl2905- GCCCAATCAAAGGCACGAATTCCTCGCGATGCTTT del-3F CC 58 NCgl2905- GCAGGTCGACTCTAGACTAGACCAACTTGAGGTAG del-3R AGG Further, through PCR reaction and sequencing based on the nucleotide sequence of Corynebacterium glutamicum ATCC 13032, an amino acid sequence (SEQ ID NO: 59) and a nucleotide sequence (SEQ ID NO: 60) of the gene having homology to NCg12905 of Corynebacterium glutamicum ATCC 13869 were obtained from NIH GenBank.

Plasmid Preparation:

Article Title: Putrescine-producing microorganism and method of producing putrescine using the same
Article Snippet: The fusion cloning was performed using an In-Fusion® HD cloning kit (Clontech). .. TABLE 8 SEQ ID NO. Primer Sequence (5′-3′) 12 NCgl1512_5F CCGGGGATCCTCTAGAGTAGACGCT TGATTGGCGGAC 13 NCgl1512_5R TCCTTCCTGGGTTAAACCGGG 18 NCgl1512-PC7-F gtttaacccaggaaggaGCCGGCAT AGCCTACCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 19 NCgl1512-PC7-ATG-F aaggaaacactgatatcaTGACCAC CTTGACGCTGTCAC 15 NCgl1512_3R GCAGGTCGACTCTAGAGTCGAATAG GCCACGCTCAC Similarly, three gene fragments were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers, and a vector was prepared in the same manner as above. .. TABLE 8 SEQ ID NO. Primer Sequence (5′-3′) 12 NCgl1512_5F CCGGGGATCCTCTAGAGTAGACGCT TGATTGGCGGAC 13 NCgl1512_5R TCCTTCCTGGGTTAAACCGGG 18 NCgl1512-PC7-F gtttaacccaggaaggaGCCGGCAT AGCCTACCGAT 6 PC7-R GATATCAGTGTTTCCTTTCGTTGG 19 NCgl1512-PC7-ATG-F aaggaaacactgatatcaTGACCAC CTTGACGCTGTCAC 15 NCgl1512_3R GCAGGTCGACTCTAGAGTCGAATAG GCCACGCTCAC Similarly, three gene fragments were amplified using the chromosome of Corynebacterium glutamicum ATCC 13869 strain as a template and the same primers, and a vector was prepared in the same manner as above.

Review